Accession | MI0031335 |
Name | oha-mir-130a |
similar to following miRCarta precursors | oha-37085-25836.1 |
Organism | Ophiophagus hannah |
Genome | OphHan1.0 |
Location |
AZIM01005047.1:55,733-55,810 (-) |
miRNA | oha-miR-130a-5p |
miRNA | oha-miR-130a-3p |
Sequence (5' -> 3') (78 nts) |
CUGUGCCCUUUUUCUGUUGUACUACUGGGAGCUCUCAUUAGCAGUGCAAUAUUAAAAGGGCAUUGGCUGGCAGAGGUU |
MFE | -28.10 kcal/mol |
first miRBase version | 21.0 |
last miRBase version | 21.0 |
Clusters (10 kb) (2 precursors) |
oha-mir-301b
oha-mir-130a |
Family | mir-130 (MIPF0000034) |
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Vonk et al. | Proc. Natl. Acad. Sci. U.S.A. | 2013 | 24297900 | The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system. |