Precursor miRBase

oha-mir-124-4 (MI0031325)

Accession MI0031325
Name oha-mir-124-4
similar to following miRCarta precursors oha-947-37025.1
Organism Ophiophagus hannah
Genome OphHan1.0
Location AZIM01002341.1:221,536-221,612 (-)
miRNA oha-miR-124-5p
miRNA oha-miR-124-4-3p
Sequence (5' -> 3')
(77 nts)
CCCUCUCUGCGUGUUCACAGCGGACCUUGAUUUAAAUGUCCAUACAAUUAAGGCACGCGGUGAAUGCUAAGAACGAG
MFE -25.60 kcal/mol
first miRBase version 21.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
oha-mir-124-4
Family mir-124 (MIPF0000021)

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Vonk et al. Proc. Natl. Acad. Sci. U.S.A. 2013 24297900 The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system.