| Accession | MI0031324 |
| Name | oha-mir-124-2 |
| similar to following miRCarta precursors | oha-946-837.1 |
| Organism | Ophiophagus hannah |
| Genome | OphHan1.0 |
| Location |
AZIM01011395.1:15,888-15,964 (-) |
| miRNA | oha-miR-124-5p |
| miRNA | oha-miR-124-3p |
| Sequence (5' -> 3') (77 nts) |
CCUUCUCUCCGUGUUCACAGCGGACCUUGAUUUAAUGUCCAUACAAUUAAGGCACGCGGUGAAUGCCAAGAGAUCGG |
| MFE | -29.60 kcal/mol |
| first miRBase version | 21.0 |
| last miRBase version | 21.0 |
| Clusters (10 kb) (1 precursors) |
oha-mir-124-2 |
| Family | mir-124 (MIPF0000021) |
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Vonk et al. | Proc. Natl. Acad. Sci. U.S.A. | 2013 | 24297900 | The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system. |