Precursor miRBase

oha-mir-107 (MI0031316)

Accession MI0031316
Name oha-mir-107
similar to following miRCarta precursors oha-2826-78.1
Organism Ophiophagus hannah
Genome OphHan1.0
Location AZIM01001029.1:157,003-157,081 (+)
miRNA oha-miR-107-5p
miRNA oha-miR-107-3p
Sequence (5' -> 3')
(79 nts)
CUCUUUGCUUUCAGCUUCUUUACAGUGUUGCCUUGUGGCAUGGAGUUCAAGCAGCAUUGUACAGGGCUAUCAAAGCAUA
MFE -27.60 kcal/mol
first miRBase version 21.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
oha-mir-107
Family mir-103 (MIPF0000024)

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Vonk et al. Proc. Natl. Acad. Sci. U.S.A. 2013 24297900 The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system.