| Accession | MI0031287 | ||||
| Name | tch-mir-192 | ||||
| similar to following miRCarta precursors | tch-59.1 | ||||
| Organism | Tupaia chinensis | ||||
| Genome | TupChi_1.0 | ||||
| Location |
KB320702.1:1,746,694-1,746,759 (-) |
||||
| miRNA | tch-miR-192-5p | ||||
| Sequence (5' -> 3') (66 nts) |
CUGACCUAUGAAUUGACAGCCAGUGCCCUCGUCUCUCCUCUGGCUGCCAAUUCCAUAGGUCACAGG | ||||
| MFE | -29.60 kcal/mol | ||||
| first miRBase version | 21.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
tch-mir-192 tch-mir-194 |
||||
| Family | mir-192 (MIPF0000063) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Xu et al. | Virology | 2014 | 24314655 | microRNA expression in hepatitis B virus infected primary treeshrew hepatocytes and the independence of intracellular miR-122 level for de novo HBV infection in culture. |