Precursor miRBase

tch-mir-455 (MI0031277)

Accession MI0031277
Name tch-mir-455
similar to following miRCarta precursors tch-135.1
Organism Tupaia chinensis
Genome TupChi_1.0
Location KB320489.1:5,301,569-5,301,628 (+)
miRNA tch-miR-455-3p
Sequence (5' -> 3')
(60 nts)
UAUGUGCCUUUGGACUACAUCGUGGGAGCCAGCACCAUGCAGUCCAUGGGCAUAUACACU
MFE -28.00 kcal/mol
first miRBase version 21.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
tch-mir-455
Family mir-455 (MIPF0000129)
Experiments
experiment Pubmed link
Illumina 24314655
External DBs
Gene symbol MIR455
NCBI Gene 104796283

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Xu et al. Virology 2014 24314655 microRNA expression in hepatitis B virus infected primary treeshrew hepatocytes and the independence of intracellular miR-122 level for de novo HBV infection in culture.