Precursor miRBase

tch-mir-671 (MI0031243)

Accession MI0031243
Name tch-mir-671
similar to following miRCarta precursors tch-316.1
Organism Tupaia chinensis
Genome TupChi_1.0
Location KB320710.1:593,893-593,952 (+)
miRNA tch-miR-671-5p
Sequence (5' -> 3')
(60 nts)
AGGAAGCCCUGGAGGGGCUGGAGGUGAUGGAUGUUUUCCUCCGGUUCUCAGGGCUCCACC
MFE -33.40 kcal/mol
first miRBase version 21.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
tch-mir-671
Family mir-671 (MIPF0000358)
Experiments
experiment Pubmed link
Illumina 24314655
External DBs
Gene symbol MIR671
NCBI Gene 104796025

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Xu et al. Virology 2014 24314655 microRNA expression in hepatitis B virus infected primary treeshrew hepatocytes and the independence of intracellular miR-122 level for de novo HBV infection in culture.