Precursor miRBase

tch-mir-140 (MI0031220)

Accession MI0031220
Name tch-mir-140
similar to following miRCarta precursors tch-173.1
Organism Tupaia chinensis
Genome TupChi_1.0
Location KB320983.1:2,385,670-2,385,732 (+)
miRNA tch-miR-140-5p
Sequence (5' -> 3')
(63 nts)
CAGUGGUUUUACCCUAUGGUAGGUUACGUCAUGCUGUUCUACCACAGGGUAGAACCACGGACA
MFE -31.50 kcal/mol
first miRBase version 21.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
tch-mir-140
Family mir-140 (MIPF0000085)
Experiments
experiment Pubmed link
Illumina 24314655
External DBs
Gene symbol MIR140
NCBI Gene 104796011

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Xu et al. Virology 2014 24314655 microRNA expression in hepatitis B virus infected primary treeshrew hepatocytes and the independence of intracellular miR-122 level for de novo HBV infection in culture.