Precursor miRBase

tch-mir-100 (MI0031214)

Accession MI0031214
Name tch-mir-100
similar to following miRCarta precursors tch-27.1
Organism Tupaia chinensis
Genome TupChi_1.0
Location KB320672.1:2,403,890-2,403,945 (-)
miRNA tch-miR-100-5p
Sequence (5' -> 3')
(56 nts)
AACCCGUAGAUCCGAACUUGUGGUGAUAGUCCACACAAGCUUGUGUCUAUAGGUCU
MFE -19.40 kcal/mol
first miRBase version 21.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
tch-mir-100
Family mir-10 (MIPF0000033)
Experiments
experiment Pubmed link
Illumina 24314655
External DBs
Gene symbol MIR100
NCBI Gene 104796007

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Xu et al. Virology 2014 24314655 microRNA expression in hepatitis B virus infected primary treeshrew hepatocytes and the independence of intracellular miR-122 level for de novo HBV infection in culture.