Precursor miRBase

tch-mir-486 (MI0031213)

Accession MI0031213
Name tch-mir-486
similar to following miRCarta precursors tch-561.1
Organism Tupaia chinensis
Genome TupChi_1.0
Location KB320466.1:2,145,585-2,145,646 (+)
miRNA tch-miR-486-3p
Sequence (5' -> 3')
(62 nts)
UCCUGUACUGAGCUGCCCCGAGGCCCUCAUCGUGCCCAGCUCGGGGCAGCUCAGUACAGGAU
MFE -47.30 kcal/mol
first miRBase version 21.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
tch-mir-486
Family mir-486 (MIPF0000220)
Experiments
experiment Pubmed link
Illumina 24314655
External DBs
Gene symbol MIR486
NCBI Gene 104797330

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Xu et al. Virology 2014 24314655 microRNA expression in hepatitis B virus infected primary treeshrew hepatocytes and the independence of intracellular miR-122 level for de novo HBV infection in culture.