| Accession | MI0031279 | ||||
| Name | tch-mir-376a-2 | ||||
| similar to following miRCarta precursors | tch-469.2 | ||||
| Organism | Tupaia chinensis | ||||
| Genome | TupChi_1.0 | ||||
| Location |
KB321140.1:4,901,294-4,901,351 (+) |
||||
| miRNA | tch-miR-376a-3p | ||||
| Sequence (5' -> 3') (58 nts) |
GUAGAUUCUCCUUCUAUGAGUACAUUAUUUAUGAUUAAUCAUAGAGGAAAAUCCACGU | ||||
| MFE | -15.80 kcal/mol | ||||
| first miRBase version | 21.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (6 precursors) |
tch-mir-376c
tch-mir-376a-1 tch-mir-376b tch-mir-376a-2 tch-mir-381 tch-mir-539 |
||||
| Family | mir-368 (MIPF0000091) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Xu et al. | Virology | 2014 | 24314655 | microRNA expression in hepatitis B virus infected primary treeshrew hepatocytes and the independence of intracellular miR-122 level for de novo HBV infection in culture. |