Accession | MI0031196 | ||||
Name | tch-mir-376a-1 | ||||
similar to following miRCarta precursors | tch-469.1 | ||||
Organism | Tupaia chinensis | ||||
Genome | TupChi_1.0 | ||||
Location |
KB321140.1:4,900,596-4,900,653 (+) |
||||
miRNA | tch-miR-376a-3p | ||||
Sequence (5' -> 3') (58 nts) |
GUAGAUUCUCCUUCUAUGAUUACGUGCUUGAUGGUUAAUCAUAGAGGAAAAUCCACGU | ||||
MFE | -19.60 kcal/mol | ||||
first miRBase version | 21.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (6 precursors) |
tch-mir-376c
tch-mir-376a-1 tch-mir-376b tch-mir-376a-2 tch-mir-381 tch-mir-539 |
||||
Family | mir-368 (MIPF0000091) | ||||
Experiments |
|
||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Xu et al. | Virology | 2014 | 24314655 | microRNA expression in hepatitis B virus infected primary treeshrew hepatocytes and the independence of intracellular miR-122 level for de novo HBV infection in culture. |