Precursor miRBase

tch-mir-9-3 (MI0031250)

Accession MI0031250
Name tch-mir-9-3
similar to following miRCarta precursors tch-104.1
Organism Tupaia chinensis
Genome TupChi_1.0
Location KB320890.1:825,879-825,939 (-)
miRNA tch-miR-9-5p
Sequence (5' -> 3')
(61 nts)
UCUUUGGUUAUCUAGCUGUAUGAGUGGUGUGGAGUCUUCAUAAAGCUAGAUAACCGAAAGU
MFE -25.80 kcal/mol
first miRBase version 21.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
tch-mir-9-3
Family mir-9 (MIPF0000014)
Experiments
experiment Pubmed link
Illumina 24314655
External DBs
Gene symbol MIR9-3
NCBI Gene 104796608

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Xu et al. Virology 2014 24314655 microRNA expression in hepatitis B virus infected primary treeshrew hepatocytes and the independence of intracellular miR-122 level for de novo HBV infection in culture.