Precursor miRBase

tch-mir-135b (MI0031176)

Accession MI0031176
Name tch-mir-135b
similar to following miRCarta precursors tch-321.1
Organism Tupaia chinensis
Genome TupChi_1.0
Location KB321094.1:3,860,853-3,860,913 (-)
miRNA tch-miR-135b-5p
Sequence (5' -> 3')
(61 nts)
UAUGGCUUUUCAUUCCUAUGUGAUUGCUGUUCCAAACUCAUGUAGGGCUAAAAGCCAUGGG
MFE -21.70 kcal/mol
first miRBase version 21.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
tch-mir-135b
Family mir-135 (MIPF0000028)
Experiments
experiment Pubmed link
Illumina 24314655
External DBs
Gene symbol MIR135B
NCBI Gene 104795983

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Xu et al. Virology 2014 24314655 microRNA expression in hepatitis B virus infected primary treeshrew hepatocytes and the independence of intracellular miR-122 level for de novo HBV infection in culture.