Precursor miRBase

tch-mir-107 (MI0031166)

Accession MI0031166
Name tch-mir-107
similar to following miRCarta precursors tch-78.1
Organism Tupaia chinensis
Genome TupChi_1.0
Location KB320639.1:1,831,420-1,831,477 (-)
miRNA tch-miR-107
Sequence (5' -> 3')
(58 nts)
AGCUUCUUUACAGUGUUGCCUUGUGGCAUGGAGUUCAAGCAGCAUUGUACAGGGCUAU
MFE -21.80 kcal/mol
first miRBase version 21.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
tch-mir-107
Family mir-103 (MIPF0000024)
Experiments
experiment Pubmed link
Illumina 24314655
External DBs
Gene symbol MIR107
NCBI Gene 104795977

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Xu et al. Virology 2014 24314655 microRNA expression in hepatitis B virus infected primary treeshrew hepatocytes and the independence of intracellular miR-122 level for de novo HBV infection in culture.