Accession | MI0031159 | ||||
Name | tch-mir-409 | ||||
similar to following miRCarta precursors | tch-233.1 | ||||
Organism | Tupaia chinensis | ||||
Genome | TupChi_1.0 | ||||
Location |
KB321140.1:4,927,019-4,927,072 (+) |
||||
miRNA | tch-miR-409-3p | ||||
Sequence (5' -> 3') (54 nts) |
AGGUUACCCGAGCAACUUUGCAUCUGGACGACGAAUGUUGCUCGGUGAACCCCU | ||||
MFE | -21.40 kcal/mol | ||||
first miRBase version | 21.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (3 precursors) |
tch-mir-409 tch-mir-369 tch-mir-656 |
||||
Family | mir-154 (MIPF0000018) | ||||
Experiments |
|
||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Xu et al. | Virology | 2014 | 24314655 | microRNA expression in hepatitis B virus infected primary treeshrew hepatocytes and the independence of intracellular miR-122 level for de novo HBV infection in culture. |