Precursor miRBase

tch-mir-32 (MI0031143)

Accession MI0031143
Name tch-mir-32
similar to following miRCarta precursors tch-208.1
Organism Tupaia chinensis
Genome TupChi_1.0
Location KB320489.1:121,016-121,077 (-)
miRNA tch-miR-32-5p
Sequence (5' -> 3')
(62 nts)
UAUUGCACAUUACUAAGUUGCAUGUUGUCACGGCCUCAAUGCAAUUUAGUGUGUGUGAUAUU
MFE -24.30 kcal/mol
first miRBase version 21.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
tch-mir-32
Family mir-32 (MIPF0000069)
Experiments
experiment Pubmed link
Illumina 24314655
External DBs
Gene symbol MIR32
NCBI Gene 104795963

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Xu et al. Virology 2014 24314655 microRNA expression in hepatitis B virus infected primary treeshrew hepatocytes and the independence of intracellular miR-122 level for de novo HBV infection in culture.