Precursor miRBase

tch-mir-103a-1 (MI0031139)

Accession MI0031139
Name tch-mir-103a-1
similar to following miRCarta precursors tch-13.1
Organism Tupaia chinensis
Genome TupChi_1.0
Location KB320659.1:3,222,083-3,222,144 (+)
miRNA tch-miR-103a-3p
Sequence (5' -> 3')
(62 nts)
UCGGCUUCUUUACAGUGCUGCCUUGUUGCAUAUGGAUCAAGCAGCAUUGUACAGGGCUAUGA
MFE -22.70 kcal/mol
first miRBase version 21.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
tch-mir-103a-1
Family mir-103 (MIPF0000024)
Experiments
experiment Pubmed link
Illumina 24314655
External DBs
Gene symbol MIR103A-1
NCBI Gene 104795960

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Xu et al. Virology 2014 24314655 microRNA expression in hepatitis B virus infected primary treeshrew hepatocytes and the independence of intracellular miR-122 level for de novo HBV infection in culture.