Precursor miRBase

tch-mir-7-1 (MI0031124)

Accession MI0031124
Name tch-mir-7-1
similar to following miRCarta precursors tch-402.1
Organism Tupaia chinensis
Genome TupChi_1.0
Location KB370753.1:2,231,644-2,231,703 (+)
miRNA tch-miR-7-5p
Sequence (5' -> 3')
(60 nts)
UGGAAGACUAGUGAUUUUGUUGUUCUGAUAUGUGAUGACAACAAGUCACAGCCGGCCUCA
MFE -13.90 kcal/mol
first miRBase version 21.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
tch-mir-7-1
Family mir-7 (MIPF0000022)
Experiments
experiment Pubmed link
Illumina 24314655
External DBs
Gene symbol MIR7-1
NCBI Gene 104795950

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Xu et al. Virology 2014 24314655 microRNA expression in hepatitis B virus infected primary treeshrew hepatocytes and the independence of intracellular miR-122 level for de novo HBV infection in culture.