Precursor miRBase

tch-mir-210 (MI0031123)

Accession MI0031123
Name tch-mir-210
similar to following miRCarta precursors tch-102.1
Organism Tupaia chinensis
Genome TupChi_1.0
Location KB364419.1:831,425-831,484 (+)
miRNA tch-miR-210
Sequence (5' -> 3')
(60 nts)
AGCCACUGCCCACCGCACACUGCGCUGCUCCGGACCCACUGUGCGUGUGACAGCGGCUGA
MFE -23.00 kcal/mol
first miRBase version 21.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
tch-mir-210
Family mir-210 (MIPF0000086)
Experiments
experiment Pubmed link
Illumina 24314655
External DBs
Gene symbol MIR210
NCBI Gene 104796277

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Xu et al. Virology 2014 24314655 microRNA expression in hepatitis B virus infected primary treeshrew hepatocytes and the independence of intracellular miR-122 level for de novo HBV infection in culture.