| Accession | MI0031103 |
| Name | ppy-mir-517c-3 |
| similar to following miRCarta precursors | ppy-933-904.1 ppy-933-904.2 |
| Organism | Pongo abelii |
| Genome | PPYG2 |
| Location |
19:55,496,593-55,496,684 (+) |
| miRNA | ppy-miR-517c-5p |
| miRNA | ppy-miR-517c-?? |
| Sequence (5' -> 3') (92 nts) |
UGUGACCCUCUAGAUGGAAGCACUGUCUGUUGUCUAAUAAAAGAUCGUGCAUCCUUUUAGAGUGUUACUGUUUGAGAAAAGCAACGUUGAAG |
| MFE | -31.10 kcal/mol |
| first miRBase version | 21.0 |
| last miRBase version | 21.0 |
| Clusters (10 kb) (10 precursors) |
ppy-mir-519d
ppy-mir-521-2 ppy-mir-520d ppy-mir-517c-2 ppy-mir-520g ppy-mir-517c-3 ppy-mir-520g ppy-mir-516b-2 ppy-mir-518g ppy-mir-1283b |
| Family | mir-515 (MIPF0000020) |
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Kamanu et al. | Sci Rep | 2013 | 24126940 | Exploration of miRNA families for hypotheses generation. |