| Accession | MI0031094 | ||||
| Name | ggo-mir-516a-2 | ||||
| similar to following miRCarta precursors | ggo-852.1 | ||||
| Organism | Gorilla gorilla | ||||
| Genome | GorGor3 | ||||
| Location |
19:51,220,847-51,220,956 (+) |
||||
| miRNA | ggo-miR-516a | ||||
| Sequence (5' -> 3') (110 nts) |
CUGGAGCAAGAAGAUCUCAGGCUGUGACCUUCUCGAGGAAAGAAGCACUUUCUGUUGUCUGAAAGAAAAGAAAGUGCUUCCUUCCAGAGGGUUACGGUUUGAGAAAAGCA | ||||
| MFE | -52.60 kcal/mol | ||||
| first miRBase version | 21.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (7 precursors) |
ggo-mir-519a-1
ggo-mir-1283-2 ggo-mir-516a-1 ggo-mir-1283-3 ggo-mir-516a-2 ggo-mir-516b-2 ggo-mir-519a-2 |
||||
| Family | mir-515 (MIPF0000020) | ||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Kamanu et al. | Sci Rep | 2013 | 24126940 | Exploration of miRNA families for hypotheses generation. |