Accession | MI0031082 | ||||
Name | ggo-mir-518e | ||||
similar to following miRCarta precursors | ggo-733-888.1 | ||||
Organism | Gorilla gorilla | ||||
Genome | GorGor3 | ||||
Location |
19:51,185,931-51,186,028 (+) |
||||
miRNA | ggo-miR-518e-5p | ||||
miRNA | ggo-miR-518e-3p | ||||
Sequence (5' -> 3') (98 nts) |
CAAGAUCUCAGGCUGUGACCCUCUAGAGGGAAGCGCUUUCUGUUGGCUAAAAGAAAAGAAAGCGCUUCCCUUCAGAGUGUUACGCUUUGAGAAAAGCA | ||||
MFE | -48.60 kcal/mol | ||||
first miRBase version | 21.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (4 precursors) |
ggo-mir-526a
ggo-mir-518e ggo-mir-518d ggo-mir-1283-1 |
||||
Family | mir-515 (MIPF0000020) | ||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Kamanu et al. | Sci Rep | 2013 | 24126940 | Exploration of miRNA families for hypotheses generation. |