| Accession | MI0030998 | ||||
| Name | ocu-mir-191 | ||||
| similar to following miRCarta precursors | ocu-48-32254.1 | ||||
| Organism | Oryctolagus cuniculus | ||||
| Genome | OryCun2.0 | ||||
| Location |
chr9:16,649,737-16,649,828 (-) |
||||
| miRNA | ocu-miR-191-5p | ||||
| miRNA | ocu-miR-191-3p | ||||
| Sequence (5' -> 3') (92 nts) |
CGGCUGGACAGCGGGCAACGGAAUCCCAAAAGCAGCUGUUGUCUCCAGAGCAUUCCAGCUGCGCUUGGAUUUCGUUCCCUGCUUUCCUGCCU | ||||
| MFE | -47.90 kcal/mol | ||||
| first miRBase version | 21.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
ocu-mir-191 |
||||
| Family | mir-191 (MIPF0000194) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Maraghechi et al. | Reproduction | 2013 | 23426804 | Discovery of pluripotency-associated microRNAs in rabbit preimplantation embryos and embryonic stem-like cells. |