| Accession | MI0030989 | ||||
| Name | ocu-mir-302a | ||||
| similar to following miRCarta precursors | ocu-32190-838.1 | ||||
| Organism | Oryctolagus cuniculus | ||||
| Genome | OryCun2.0 | ||||
| Location |
chr15:36,769,946-36,770,014 (+) |
||||
| miRNA | ocu-miR-302a-5p | ||||
| miRNA | ocu-miR-302a-3p | ||||
| Sequence (5' -> 3') (69 nts) |
CCACCACUUAAACGUGGAUGUACUUGCUUUGAAACUAAAAAAGUAAGUGCUUCCAUGUUUUGGUGAUGG | ||||
| MFE | -33.70 kcal/mol | ||||
| first miRBase version | 21.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (5 precursors) |
ocu-mir-302b
ocu-mir-302c ocu-mir-302a ocu-mir-302d ocu-mir-367 |
||||
| Family | mir-302 (MIPF0000071) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Maraghechi et al. | Reproduction | 2013 | 23426804 | Discovery of pluripotency-associated microRNAs in rabbit preimplantation embryos and embryonic stem-like cells. |