| Accession | MI0030796 | ||||
| Name | chi-mir-449c | ||||
| similar to following miRCarta precursors | chi-27857.1 | ||||
| Organism | Capra hircus | ||||
| Genome | CHIR_1.0 | ||||
| Location |
chr20:23,891,790-23,891,890 (+) |
||||
| miRNA | chi-miR-449c | ||||
| Sequence (5' -> 3') (101 nts) |
AAGCUUGAAUGUGUCAGGUAGGCAGUGCAUCUCUAGCUGGCUGUUAAUAUUUCAUUUUAACAGUUGCUAGUUGCACUCCCCGCUGUUGCAUUCAUAAUCUU | ||||
| MFE | -38.10 kcal/mol | ||||
| first miRBase version | 21.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (3 precursors) |
chi-mir-449c chi-mir-449b chi-mir-449a |
||||
| Family | mir-449 (MIPF0000133) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Wu et al. | Reprod. Domest. Anim. | 2014 | 23981187 | Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing. |