Accession | MI0030775 | ||||
Name | chi-mir-380 | ||||
similar to following miRCarta precursors | chi-36877-27881.1 | ||||
Organism | Capra hircus | ||||
Genome | CHIR_1.0 | ||||
Location |
chr21:62,829,155-62,829,257 (+) |
||||
miRNA | chi-miR-380-5p | ||||
miRNA | chi-miR-380-3p | ||||
Sequence (5' -> 3') (103 nts) |
CCUUCCCACGGUACCUGAAAAGAUGGUUGACCACAGAACAUGCGCUGUCUCUAUGUCGUAUGUAAUGUGGUCCACGUCUUCUCAAUAUCAAAUUCAGUCGCAG | ||||
MFE | -29.80 kcal/mol | ||||
first miRBase version | 21.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (12 precursors) |
chi-mir-379
chi-mir-411a chi-mir-380 chi-mir-411b chi-mir-1197 chi-mir-323a chi-mir-758 chi-mir-329b chi-mir-329a chi-mir-494 chi-mir-543 chi-mir-495 |
||||
Family | mir-379 (MIPF0000126) | ||||
Experiments |
|
||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Wu et al. | Reprod. Domest. Anim. | 2014 | 23981187 | Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing. |