| Accession | MI0030735 | ||||
| Name | chi-mir-30e | ||||
| similar to following miRCarta precursors | chi-24-25.1 | ||||
| Organism | Capra hircus | ||||
| Genome | CHIR_1.0 | ||||
| Location |
chr3:101,654,094-101,654,199 (-) |
||||
| miRNA | chi-miR-30e-5p | ||||
| miRNA | chi-miR-30e-3p | ||||
| Sequence (5' -> 3') (106 nts) |
UUCUGGGCAGUCUUUGCUACUGUAAACAUCCUUGACUGGAAGCUGUAAGGCGUUGCAAGGAGCUUUCAGUCGGAUGUUUACAGCGGCAGGCUGCCACGGUCAUCCC | ||||
| MFE | -55.70 kcal/mol | ||||
| first miRBase version | 21.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
chi-mir-30c
chi-mir-30e |
||||
| Family | mir-30 (MIPF0000005) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Wu et al. | Reprod. Domest. Anim. | 2014 | 23981187 | Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing. |