| Accession | MI0030691 | ||||
| Name | chi-mir-21 | ||||
| similar to following miRCarta precursors | chi-1-25100.1 | ||||
| Organism | Capra hircus | ||||
| Genome | CHIR_1.0 | ||||
| Location |
chr19:10,239,516-10,239,607 (+) |
||||
| miRNA | chi-miR-21-5p | ||||
| miRNA | chi-miR-21-3p | ||||
| Sequence (5' -> 3') (92 nts) |
UGUACCACCUUGUCGGGUAGCUUAUCAGACUGAUGUUGACUGUUGAAUCUCAUGGCAACAGCAGUCGAUGGGCUGUCUGACAUUUUGGUAUC | ||||
| MFE | -42.60 kcal/mol | ||||
| first miRBase version | 21.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
chi-mir-21 |
||||
| Family | mir-21 (MIPF0000060) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Wu et al. | Reprod. Domest. Anim. | 2014 | 23981187 | Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing. |