| Accession | MI0030605 | ||||
| Name | chi-mir-125a | ||||
| similar to following miRCarta precursors | chi-63-333.1 | ||||
| Organism | Capra hircus | ||||
| miRNA | chi-miR-125a-5p | ||||
| miRNA | chi-miR-125a-3p | ||||
| Sequence (5' -> 3') (74 nts) |
CGUCCCUGAGACCCUUUAACCUGUGAGGACGUCCAGGGUCACAGGUGAGGUUCUUGGGAGCCUGGCGUCCGGCC | ||||
| MFE | -30.10 kcal/mol | ||||
| first miRBase version | 21.0 | ||||
| last miRBase version | 21.0 | ||||
| Family | mir-10 (MIPF0000033) | ||||
| Experiments |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Wu et al. | Reprod. Domest. Anim. | 2014 | 23981187 | Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing. |