| Accession | MI0030580 | ||||
| Name | chi-let-7b | ||||
| similar to following miRCarta precursors | chi-14-36851.1 | ||||
| Organism | Capra hircus | ||||
| Genome | CHIR_1.0 | ||||
| Location |
chr5:107,025,801-107,025,897 (-) |
||||
| miRNA | chi-let-7b-5p | ||||
| miRNA | chi-let-7b-3p | ||||
| Sequence (5' -> 3') (97 nts) |
GGCGGGGUGAGGUAGUAGGUUGUGUGGUUUCAGGGUAGUGAUGUUGCCCCCUCGGAAGAUAACUAUACAACCUACUGCCUUCCUUGAGGGGCCCAGU | ||||
| MFE | -43.00 kcal/mol | ||||
| first miRBase version | 21.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
chi-let-7b chi-let-7a |
||||
| Family | let-7 (MIPF0000002) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Wu et al. | Reprod. Domest. Anim. | 2014 | 23981187 | Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing. |