Precursor miRBase

efu-mir-140 (MI0028907)

Accession MI0028907
Name efu-mir-140
similar to following miRCarta precursors efu-173.1
Organism Eptesicus fuscus
Genome EptFus1.0
Location JH977621.1:26,675,351-26,675,479 (+)
miRNA efu-miR-140
Sequence (5' -> 3')
(129 nts)
CCCGCCCUGUGUGUGUCCGUCUCUCUGUGUCCUGCCAGUGGUUUUACCCUAUGGUAGGUUACGUCAUGCUGUUCUACCACAGGGUAGAACCACGGACAGGAUACCGGGGCACCCUCUGCAUCGAAGGAC
MFE -57.40 kcal/mol
first miRBase version 21.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
efu-mir-140
Family mir-140 (MIPF0000085)
Experiments
experiment Pubmed link
Illumina 24692655
External DBs
Gene symbol MIR140
NCBI Gene 104796544

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Platt et al. Mol. Biol. Evol. 2014 24692655 Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats.