Accession | MI0028701 | ||||
Name | efu-let-7d | ||||
similar to following miRCarta precursors | efu-90.1 | ||||
potential naming conflicts with | efu-let-7d (MIMAT0035016) | ||||
Organism | Eptesicus fuscus | ||||
Genome | EptFus1.0 | ||||
Location |
JH977714.1:1,026,602-1,026,734 (+) |
||||
miRNA | efu-let-7d | ||||
Sequence (5' -> 3') (133 nts) |
AGACUGGCAAGAAAAAAAAGGGGGGGUUCCUAGGAAGAGGUAGUAGGUUGCAUAGUUUUAGGGCAGGGAUUUUGCCCACAAGGAGGUAACUAUACGACCUGCUGCCUUUCUUAGGGCCUUAUUAUUCCACGGU | ||||
MFE | -50.10 kcal/mol | ||||
first miRBase version | 21.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (2 precursors) |
efu-let-7f
efu-let-7d |
||||
Family | let-7 (MIPF0000002) | ||||
Experiments |
|
||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Platt et al. | Mol. Biol. Evol. | 2014 | 24692655 | Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats. |