| Accession | MI0028691 | ||||
| Name | efu-mir-26c | ||||
| similar to following miRCarta precursors | efu-33.1 | ||||
| Organism | Eptesicus fuscus | ||||
| Genome | EptFus1.0 | ||||
| Location |
JH977659.1:2,129,695-2,129,799 (-) |
||||
| miRNA | efu-miR-26c | ||||
| Sequence (5' -> 3') (105 nts) |
CCACAGAGGCUGUGGCUGGAUUCAAGUAAUCCAGGAUAGGCUGUUUCCACCUGUGAGGCCUAUUCUUGAUUACUUGUUUCUGGAGGCAGCUGAUGGUUCGCCGCU | ||||
| MFE | -45.30 kcal/mol | ||||
| first miRBase version | 21.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
efu-mir-26c |
||||
| Family | mir-26 (MIPF0000043) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Platt et al. | Mol. Biol. Evol. | 2014 | 24692655 | Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats. |