Accession | MI0026454 | ||||
Name | ssa-mir-125b-1 | ||||
similar to following miRCarta precursors | ssa-26000-31738.1 | ||||
Organism | Salmo salar | ||||
miRNA | ssa-miR-125b-5p | ||||
miRNA | ssa-miR-125b-1-3p | ||||
Sequence (5' -> 3') (57 nts) |
UCCCUGAGACCCUUAACCUGUGAGGUCAUAGUAGGUCACAGGUGAGGUCCUCGGGAA | ||||
MFE | -26.60 kcal/mol | ||||
first miRBase version | 21.0 | ||||
last miRBase version | 21.0 | ||||
Family | mir-10 (MIPF0000033) | ||||
Experiments |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Andreassen et al. | BMC Genomics | 2013 | 23865519 | Discovery and characterization of miRNA genes in Atlantic salmon (Salmo salar) by use of a deep sequencing approach. |