| Accession | MI0008027 | ||||
| Name | cfa-mir-486 | ||||
| similar to following miRCarta precursors | cfa-106-32133.1 | ||||
| Organism | Canis familiaris | ||||
| Genome | CanFam3.1 | ||||
| Location |
chr16:23,958,963-23,959,026 (-) |
||||
| miRNA | cfa-miR-486 | ||||
| miRNA | cfa-miR-486-3p | ||||
| Sequence (5' -> 3') (64 nts) |
UCCUGUACUGAGCUGCCCCGAGCUGAGCGCAGUGAAUGGCCUCGGGGCAGCUCAGUACAGGAUC | ||||
| MFE | -49.10 kcal/mol | ||||
| first miRBase version | 21.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
cfa-mir-486 |
||||
| Family | mir-486 (MIPF0000220) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Friedländer et al. | Nat. Biotechnol. | 2008 | 18392026 | Discovering microRNAs from deep sequencing data using miRDeep. |
| 2 | Platt et al. | Mol. Biol. Evol. | 2014 | 24692655 | Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats. |