| Accession | MI0031781 | ||||||
| Name | rno-mir-542-2 | ||||||
| similar to following miRCarta precursors | rno-25650-136.1 rno-25650-136.2 rno-25650-136.3 | ||||||
| Organism | Rattus norvegicus | ||||||
| Genome | Rnor_5.0 | ||||||
| Location |
chrX:152,784,192-152,784,270 (+) |
||||||
| miRNA | rno-miR-542-5p | ||||||
| miRNA | rno-miR-542-3p | ||||||
| Sequence (5' -> 3') (79 nts) |
UCUCAGACGUCUCGGGGAUCAUCAUGUCACGAGAUACCACUGCGCACUUGUGACAGAUUGAUAACUGAAAGGUCUGGGA | ||||||
| MFE | -33.20 kcal/mol | ||||||
| first miRBase version | 21.0 | ||||||
| last miRBase version | 21.0 | ||||||
| Clusters (10 kb) (5 precursors) |
rno-mir-351-1
rno-mir-542-1 rno-mir-450b-1 rno-mir-450a rno-mir-542-2 |
||||||
| Family | mir-542 (MIPF0000185) | ||||||
| Experiments |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Sewer et al. | BMC Bioinformatics | 2005 | 16274478 | Identification of clustered microRNAs using an ab initio prediction method. |
| 2 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 3 | Linsen et al. | BMC Genomics | 2010 | 20403161 | Small RNA expression and strain specificity in the rat. |