| Accession | MI0026028 | ||||
| Name | mmu-mir-142b | ||||
| similar to following miRCarta precursors | mmu-25102.1 | ||||
| Organism | Mus musculus | ||||
| Genome | GRCm38.p5 | ||||
| Location |
chr11:87,756,841-87,756,955 (-) |
||||
| miRNA | mmu-miR-142b | ||||
| Sequence (5' -> 3') (115 nts) |
GCGUGGUCUCCGAAGCCCACAGUGCACUCAUCCAUAAAGUAGGAAACACUACACCCUCCAGUGCUGUUAGUAGUGCUUUCUACUUUAUGGGUGACUGCACUGUCUGUCUGUCCAC | ||||
| MFE | -49.60 kcal/mol | ||||
| first miRBase version | 20.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
mmu-mir-142b mmu-mir-142a |
||||
| Family | mir-142 (MIPF0000084) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Polikepahad et al. | Nucleic Acids Res. | 2013 | 23185045 | Profiling of T helper cell-derived small RNAs reveals unique antisense transcripts and differential association of miRNAs with argonaute proteins 1 and 2. |