| Accession | MI0025285 | ||||
| Name | oar-mir-99a | ||||
| similar to following miRCarta precursors | oar-64.1 | ||||
| Organism | Ovis aries | ||||
| Genome | Oar_v3.1 | ||||
| Location |
chr1:138,829,036-138,829,116 (-) |
||||
| miRNA | oar-miR-99a | ||||
| Sequence (5' -> 3') (81 nts) |
CCCAUUGGCAUAAACCCGUAGAUCCGAUCUUGUGGUGAAGUGGACCGCACAAGCUCGCUUCUAUGGGUCUGUGUCAGUGUG | ||||
| MFE | -39.50 kcal/mol | ||||
| first miRBase version | 20.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
oar-let-7c
oar-mir-99a |
||||
| Family | mir-10 (MIPF0000033) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Galio et al. | Physiol. Genomics | 2013 | 23269700 | MicroRNA in the ovine mammary gland during early pregnancy: spatial and temporal expression of miR-21, miR-205, and miR-200. |