| Accession | MI0025275 | ||||
| Name | oar-mir-27a | ||||
| similar to following miRCarta precursors | oar-43.1 | ||||
| Organism | Ovis aries | ||||
| Genome | Oar_v3.1 | ||||
| Location |
chr5:9,936,230-9,936,307 (+) |
||||
| miRNA | oar-miR-27a | ||||
| Sequence (5' -> 3') (78 nts) |
UGGCCUGGGGAGCAGGGCUUAGCUGCUUGUGAGCAGGUCCACAUCAAGUCGUGUUCACAGUGGCUAAGUUCCGCCCCC | ||||
| MFE | -37.30 kcal/mol | ||||
| first miRBase version | 20.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
oar-mir-23a
oar-mir-27a |
||||
| Family | mir-27 (MIPF0000036) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Galio et al. | Physiol. Genomics | 2013 | 23269700 | MicroRNA in the ovine mammary gland during early pregnancy: spatial and temporal expression of miR-21, miR-205, and miR-200. |