| Accession | MI0025240 | ||||
| Name | hsa-mir-7704 | ||||
| similar to following miRCarta precursors | hsa-352.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr2:176,188,843-176,188,901 (+) |
||||
| miRNA | hsa-miR-7704 | ||||
| Sequence (5' -> 3') (59 nts) |
CGGGGUCGGCGGCGACGUGCUCAGCUUGGCACCCAAGUUCUGCCGCUCCGACGCCCGGC | ||||
| MFE | -30.40 kcal/mol | ||||
| first miRBase version | 20.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
hsa-mir-7704 |
||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Swaminathan et al. | Biochem. Biophys. Res. Commun. | 2013 | 23535375 | Interleukin-27 treated human macrophages induce the expression of novel microRNAs which may mediate anti-viral properties. |