Accession | MI0025193 | ||||
Name | bta-mir-133c | ||||
similar to following miRCarta precursors | bta-27708.1 | ||||
Organism | Bos taurus | ||||
Genome | UMD3.1 | ||||
Location |
chr13:55,227,289-55,227,382 (+) |
||||
miRNA | bta-miR-133c | ||||
Sequence (5' -> 3') (94 nts) |
GCCAUCAAUGCGCAGCUACAGCUGGUUGAAGGGGACCAAAUCCAUCGAACAGUUGAUUUGGUUCCAUUUUACCAGCUUUAGCAAAGCAUUCGGU | ||||
MFE | -42.00 kcal/mol | ||||
first miRBase version | 20.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (2 precursors) |
bta-mir-133c bta-mir-133a-1 |
||||
Family | mir-133 (MIPF0000029) | ||||
Experiments |
|
||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Muroya et al. | J. Anim. Sci. | 2013 | 23100578 | Profiling of differentially expressed microRNA and the bioinformatic target gene analyses in bovine fast- and slow-type muscles by massively parallel sequencing. |