Accession | MI0023776 | ||||
Name | mdo-mir-92b | ||||
similar to following miRCarta precursors | mdo-24422-115.1 | ||||
Organism | Monodelphis domestica | ||||
Genome | monDom5 | ||||
Location |
chr2:189,889,682-189,889,743 (+) |
||||
miRNA | mdo-miR-92b-5p | ||||
miRNA | mdo-miR-92b-3p | ||||
Sequence (5' -> 3') (62 nts) |
AGGGACGGGACGUGGUGCAGUGUUGUUCUUUCCCCGCCAAUAUUGCACUCGUCCCGGCCUCC | ||||
MFE | -32.40 kcal/mol | ||||
first miRBase version | 20.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (1 precursors) |
mdo-mir-92b |
||||
Family | mir-25 (MIPF0000013) | ||||
Experiments |
|
||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Meunier et al. | Genome Res. | 2013 | 23034410 | Birth and expression evolution of mammalian microRNA genes. |