| Accession | MI0014113 | ||||
| Name | oar-let-7b | ||||
| similar to following miRCarta precursors | oar-14.1 | ||||
| potential naming conflicts with | oar-let-7b (MIMAT0014963) | ||||
| Organism | Ovis aries | ||||
| Genome | Oar_v3.1 | ||||
| Location |
chr3:220,572,597-220,572,680 (+) |
||||
| miRNA | oar-let-7b | ||||
| Sequence (5' -> 3') (84 nts) |
CGGGGUGAGGUAGUAGGUUGUGUGGUUUCAGGGUAGUGAUGUUGCCCCCUCGGAAGAUAACUAUACAACCUACUGCCUUCCUUG | ||||
| MFE | -41.40 kcal/mol | ||||
| first miRBase version | 20.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
oar-let-7b |
||||
| Family | let-7 (MIPF0000002) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Sheng et al. | Mol. Biol. Rep. | 2011 | 20140706 | Characterization of microRNAs from sheep (Ovis aries) using computational and experimental analyses. |
| 2 | Galio et al. | Physiol. Genomics | 2013 | 23269700 | MicroRNA in the ovine mammary gland during early pregnancy: spatial and temporal expression of miR-21, miR-205, and miR-200. |