| Accession | MI0024047 | ||||
| Name | oan-mir-133a-2 | ||||
| Organism | Ornithorhynchus anatinus | ||||
| Genome | OANA5 | ||||
| Location |
Contig101:1,040,169-1,040,228 (-) |
||||
| miRNA | oan-miR-133a-5p | ||||
| miRNA | oan-miR-133a-3p | ||||
| Sequence (5' -> 3') (60 nts) |
AGCUGGUAAAAUGGAACCAAAUCAACUGUUCAAUGGAUUUGGUCCCCUUCAACCAGCUGU | ||||
| MFE | -22.50 kcal/mol | ||||
| first miRBase version | 20.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
oan-mir-133a-2 |
||||
| Family | mir-133 (MIPF0000029) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Meunier et al. | Genome Res. | 2013 | 23034410 | Birth and expression evolution of mammalian microRNA genes. |