Accession | MI0023622 | ||||
Name | hsa-mir-486-2 | ||||
similar to following miRCarta precursors | hsa-106-561.1 | ||||
Organism | Homo sapiens | ||||
Genome | GRCh38.p10 | ||||
Location |
chr8:41,660,444-41,660,507 (+) |
||||
miRNA | hsa-miR-486-5p | ||||
miRNA | hsa-miR-486-3p | ||||
Sequence (5' -> 3') (64 nts) |
UCCUGUACUGAGCUGCCCCGAGCUGGGCAGCAUGAAGGGCCUCGGGGCAGCUCAGUACAGGAUG | ||||
MFE | -49.20 kcal/mol | ||||
first miRBase version | 20.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (2 precursors) |
hsa-mir-486-1
hsa-mir-486-2 |
||||
Family | mir-486 (MIPF0000220) | ||||
Experiments |
|
||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Meunier et al. | Genome Res. | 2013 | 23034410 | Birth and expression evolution of mammalian microRNA genes. |