| Accession | MI0023423 | ||||
| Name | ccr-mir-99 | ||||
| similar to following miRCarta precursors | ccr-25991.1 | ||||
| Organism | Cyprinus carpio | ||||
| miRNA | ccr-miR-99 | ||||
| Sequence (5' -> 3') (129 nts) |
AGCCACUUGUCAUUAACCCGUAGAUCCGAUCUUGUGAUAAGUUUAAUGGCACCACCGUAGAUCCGAUCUUGUGAUAAGUUUAAUGGCACAAGCUCGUUCUAUGGGUCUCUGUCUCUGUGGUAGAAAAUC | ||||
| MFE | -34.80 kcal/mol | ||||
| first miRBase version | 19.0 | ||||
| last miRBase version | 21.0 | ||||
| Family | mir-10 (MIPF0000033) | ||||
| Experiments |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Yan et al. | PLoS ONE | 2012 | 22303472 | Identification and profiling of microRNAs from skeletal muscle of the common carp. |