Precursor miRBase

ccr-mir-429 (MI0023397)

Accession MI0023397
Name ccr-mir-429
similar to following miRCarta precursors ccr-24522.1
Organism Cyprinus carpio
miRNA ccr-miR-429
Sequence (5' -> 3')
(82 nts)
UUGAUGGGCGUCUUACCAGACAUGGUUAGAUCUAAUAAUUUGUGUCUAAUACUGUCUGGUAAUGCCGUCCAUUACAUGCUAA
MFE -32.40 kcal/mol
first miRBase version 19.0
last miRBase version 21.0
Family mir-8 (MIPF0000019)
Experiments
experiment Pubmed link
Illumina 22303472

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Yan et al. PLoS ONE 2012 22303472 Identification and profiling of microRNAs from skeletal muscle of the common carp.