Precursor miRBase

ccr-mir-30d (MI0023390)

Accession MI0023390
Name ccr-mir-30d
similar to following miRCarta precursors ccr-25370.1
Organism Cyprinus carpio
miRNA ccr-miR-30d
Sequence (5' -> 3')
(106 nts)
UUCAUGUGCUGGUUGUUCAUGCCUGUAAACAUCCCCGACUGGAAGCUGUGCUGUACGCAAAACAAGCUUUCAGUUGGAUGUUUGCUGCCAUCGUCCAGUUCUUUCG
MFE -37.50 kcal/mol
first miRBase version 19.0
last miRBase version 21.0
Family mir-30 (MIPF0000005)
Experiments
experiment Pubmed link
Illumina 22303472

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Yan et al. PLoS ONE 2012 22303472 Identification and profiling of microRNAs from skeletal muscle of the common carp.