| Accession | MI0023352 | ||||
| Name | ccr-mir-18c | ||||
| similar to following miRCarta precursors | ccr-25974.1 | ||||
| Organism | Cyprinus carpio | ||||
| miRNA | ccr-miR-18c | ||||
| Sequence (5' -> 3') (100 nts) |
UUUUAAUAUGGUCUUCCUGCUAAGGUGCAUCUUGUGUAGUUAGUGAAGUAGUAUAGUAUCUACUGCGCUAGAUGCUCCUUUUGGCAGGAGGAGCUGUAUA | ||||
| MFE | -43.50 kcal/mol | ||||
| first miRBase version | 19.0 | ||||
| last miRBase version | 21.0 | ||||
| Family | mir-17 (MIPF0000001) | ||||
| Experiments |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Yan et al. | PLoS ONE | 2012 | 22303472 | Identification and profiling of microRNAs from skeletal muscle of the common carp. |